Skip to content

tdortman/cuSBF

Repository files navigation

cuSBF

Documentation arXiv

Overview

cuSBF is a high-performance GPU implementation of the Super Bloom filter, optimized for high-throughput batch k-mer insertion and query on nucleotide (DNA) and protein sequences (or any other sequence type as long as a valid alphabet is provided).

It exploits the streaming nature of sequence-derived k-mers by using minimizers to group consecutive k-mers sharing the same minimiser into super-k-mers, assigning all k-mers of a super-k-mer to the same 256-bit memory shard. This amortizes random memory accesses across consecutive k-mer queries, reducing memory-bandwidth pressure. The findere scheme further reduces false positives dramatically by inserting overlapping s-mers and requiring a full run of consecutive s-mer matches.

This library is the companion code for the paper "cuSBF: A Minimizer-Aware Bloom Filter for Genomic Sequence Data on Modern GPUs".

Features

  • CUDA-accelerated batch k-mer insert and query from sequences
  • Configurable k-mer length, minimiser width, s-mer width, and hash function count
  • Minimizer-based shard selection for cache-efficient streaming queries
  • Findere false-positive reduction via overlapping s-mer membership
  • Header-only library design
  • FASTA/FASTQ stream and file support

Performance

image

Benchmarks use Config<31, 28, 16, 4> on an NVIDIA RTX PRO 6000 Blackwell GPU. CPU Super Bloom runs on an Intel Xeon W9-3595X with 120 threads.

Compared against:

Smaller Filter (C. elegans, ~100M k-mers)

Comparison Insert Query
cuSBF vs Super Bloom 92× faster 234× faster
cuSBF vs GBBF 9.1× faster 7.7× faster
cuSBF vs Cuckoo-GPU 80× faster 8.0× faster
cuSBF vs TCF 12× faster 52× faster
cuSBF vs GQF 69× faster 13× faster

Large Filter (CHM13, ~3.1B k-mers)

Comparison Insert Query
cuSBF vs Super Bloom 59× faster 165× faster
cuSBF vs GBBF 8.2× faster 7.6× faster
cuSBF vs Cuckoo-GPU 3427× faster 7.8× faster
cuSBF vs TCF 12× faster 67× faster
cuSBF vs GQF 42× faster 11× faster

False Positive Rate

Bits/k-mer cuSBF s=28 cuSBF s=30 cuSBF s=31 GBBF
21.4 0.848% 0.951% 1.593% 3.069%
85.7 0.091% 0.107% 0.210% 0.126%
342.6 0.0095% 0.0114% 0.0264% 0.0273%

Requirements

  • Linux (x86_64 or aarch64) with an NVIDIA GPU and driver
  • CUDA Toolkit >= 13.1
  • GCC or Clang host compiler (C++20)
  • Meson and Ninja
  • NVIDIA GPU with compute capability 8.0+ (Ampere, Lovelace, Hopper, Blackwell)

Platform support

cuSBF is developed and tested on Linux only.

  • WSL2 on Windows with is a reasonable dev environment (See NVIDIA docs).
  • Native Windows and macOS are not supported or tested. The build uses Linux-specific FASTX paths (for example mmap) and host tooling assumptions (GCC/Clang, GNU statement expressions in CUSBF_TRY/CUSBF_UNWRAP).

Building

meson setup build
ninja -C build

When this repo is the root Meson project, benchmarks, tests, and examples build by default. As a subproject they are skipped unless you force them on.

Option Type Default Description
benchmarks feature auto Google Benchmark binaries
tests feature auto GoogleTest suite
examples feature auto Example CLI
param_sweep feature disabled Parameter-sweep binaries (large, see below)
param_sweep_alphabet combo dna dna or protein when param_sweep is enabled
large_fastx_tests feature disabled Large generated FASTX test (CUSBF_LARGE_FASTX_* env vars)

Each feature option accepts auto, enabled, or disabled:

  • auto — on for a standalone checkout, off when cuSBF is a subproject
  • enabled / disabled — override regardless of project layout

Important

Enabling param_sweep builds many binaries (208 for the DNA alphabet). Leave it disabled unless you need that sweep.

# Default standalone build
meson setup build

# Faster configure: library + examples only
meson setup build -Dbenchmarks=disabled -Dtests=disabled

# Subproject consumer forcing tests on
meson setup build -Dtests=enabled

# Parameter sweep
meson setup build -Dparam_sweep=enabled
meson setup build -Dparam_sweep=enabled -Dparam_sweep_alphabet=protein

Usage

Fallible APIs return cusbf::Result<T> (a thin wrapper over cuda::std::expected<T, Error>). Use return Err(error) (cuda::std::unexpected<Error>, deduces Result<T>) or return Ok() / return {} for Result<void>. For success with a value, return value is enough. Two helpers unwrap results:

Macro On failure Use when
CUSBF_TRY(expr) Copies the error, then return cuda::std::unexpected<Error>(...) from the enclosing function The caller returns Result (library glue, examples/cusbf-main)
CUSBF_UNWRAP(expr) throw std::runtime_error(message()) Tests, main, or other code that does not return Result

Both work as statements or in initializers (auto x = CUSBF_UNWRAP(...)). For full control (typed errors, exit codes), use if (!result) instead.

Quick example (CUSBF_UNWRAP)

#include <cusbf/filter.cuh>

using Config = cusbf::Config<31, 28, 16, 4>;

int main() {
    cusbf::filter<Config> filter(1 << 24);

    CUSBF_UNWRAP(filter.insert_sequence("ACGTACGTACGTACGTACGTACGTACGTACGT"));
    const auto hits = CUSBF_UNWRAP(filter.contains_sequence("ACGTACGTACGTACGTACGTACGTACGTACGT"));

    CUSBF_UNWRAP(filter.insert_fastx_file("reference.fasta"));
    const auto summary = CUSBF_UNWRAP(filter.query_fastx_file("queries.fastq"));

    (void)hits;
    (void)summary;
    return 0;
}

Propagating errors (CUSBF_TRY)

When the caller already returns Result, use CUSBF_TRY so failures propagate without exceptions:

[[nodiscard]] cusbf::Result<void> run(cusbf::filter<Config>& filter) {
    CUSBF_TRY(filter.insert_fastx_file("reference.fasta"));
    const auto summary = CUSBF_TRY(filter.query_fastx_file("queries.fastq"));
    (void)summary;
    return cusbf::Ok();
}

Async device APIs, record batches, and streaming FASTX callbacks follow the same pattern. filter.load_factor() and filter.filter_bits() are synchronous and do not return Result.

Inspecting errors

if (const auto result = filter.query_fastx_file("queries.fastq"); !result) {
    const cusbf::Error& err = result.error();
    std::cerr << err.message() << '\n';
    if (const cusbf::FastxParseError* parse = err.as_fastx_parse()) {
        // parse->location.file / .line / .column
    }
    return 1;
}

CUSBF_CUDA_TRY wraps CUDA runtime calls into Result<void>; CUSBF_CUDA_CALL / CUSBF_CUDA_ABORT are for throw/abort paths only.

Configuration Options

The Config template accepts the following parameters:

Parameter Description Default
K k-mer length (max depends on alphabet) -
S s-mer width for findere Bloom hash seed (1-K) -
M Minimiser width for shard selection (1-K) -
HashCount Number of independent Bloom hash functions (4,8,12,16) 4
CudaBlockSize CUDA threads per block 256
Alphabet Symbol encoding (DNA or protein) DnaAlphabet

Protein Alphabet Support

#include <cusbf/filter.cuh>

using ProteinConfig = cusbf::Config<12, 10, 6, 4, 256, cusbf::ProteinAlphabet>;

[[nodiscard]] cusbf::Result<void> run_protein() {
    cusbf::filter<ProteinConfig> filter(1 << 24);
    CUSBF_TRY(filter.insert_sequence("ACDEFGHIKLMNPQRSTVWY"));
    const auto hits = CUSBF_TRY(filter.contains_sequence("ACDEFGHIKLMNPQRSTVWY"));
    (void)hits;
    return cusbf::Ok();
}

About

High-Performance GPU Super Bloom Filter

Resources

License

Stars

Watchers

Forks

Releases

No releases published

Packages

 
 
 

Contributors