Skip to content

combogenomics/MeStudio

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

102 Commits
 
 
 
 
 
 
 
 

Repository files navigation

MeStudio

Python C R

MeStudio is a tool which allows us to analyse and combine genome-wide methylation profiles with genomic features. MeStudio connects several procedural software components that can be run either individually or as part of a pipeline.

When you run MeStudio as a pipeline (see Installing MeStudio, ./mestudio -h) it automatically calls all the scripts and executables it needs to perform genome-wide methylation profiles analysis. Running MeStudio this way is fairly easy:

Usage: mestudio -f <str> -anno <str> -smart <str> -mo <str> -out <str>

Mandatory arguments
-f      <str>           genomic sequence file
-anno   <str>           genomic annotation file
-smart  <str>           methylated base calls file
-mo     <str>           newline delimited motifs list
-out    <str>           output directory

If you are using MeStudio, please cite our work

MeStudio version 1.0

Table of Contents

Dependencies

To properly run the scripts of MeStudio, you need some dependencies to be installed. Here down below is reported how to install each dependency, you have just to copy-paste into the shell!

pandas
pip install pandas

If you have conda installed:

conda install pandas
numpy
pip install numpy

If you have conda installed:

conda install numpy
matplotlib
pip install matplotlib

If you have conda installed:

conda install matplotlib
R package: circlize
install.packages("circlize")

Or from GitHub:

devtools::install_github("jokergoo/circlize")

Installing MeStudio (Linux users)

You have to render install executable by typing:

chmod +x install

Then you can install it with the following command:

sudo ./install

If you don't have the administrator privileges, please add the directory in which executables are present to the $PATH. Here you can find how to do it.

Installing MeStudio (Mac OSX users)

You easily run MeStudio on Max OSX by using imestudio but before starting there's a two steps passage to be done. Please manually add the path of the folder in which you want to locate MeStudio by typing:

nano imestudio

In the INSTALLATION_DIR= (line 10) you can add your path.

#!/bin/bash

## installation_dir holds the entire path to the scripts and binaries
## You either install automatically, or manually.
## When installing manually make sure you also add the installation directory
## to your PATH [https://unix.stackexchange.com/questions/26047/how-to-correctly-add-a-path-to-path]
## Linux script provided by University of Florence; The Florence Computational Biology Group;
## https://www.bio.unifi.it/vp-175-our-research.html

INSTALLATION_DIR=/insert/your/path

Save your changes (ctrl + o and then ctrl + x for closing the editor) and you're done! Please, make sure you have greadlink installed.

Ok, now you're ready to launch mestudio (or imestudio for OSX users). From now on, the code shown is the Linux one. Simply type:

mestudio

And you'll get:

Usage: mestudio -f <str> -anno <str> -smart <str> -mo <str> -out <str>

Mandatory arguments
-f      <str>           genomic sequence file
-anno   <str>           genomic annotation file
-smart  <str>           methylated base calls file
-mo     <str>           newline delimited motifs list
-out    <str>           output directory

Please feel free to use the files contained in the dataset folder to start a trial analysis or you can directly use your own. Inside the dataset folder you are going to find the three files needed to start the analysis:

FSMMA_genomic.fna is the the genome of FSMMA strain of Sinorhizobium meliloti. You can get more information here.

FSMMA_anno.gff is the product of the genomic annotation (executed via Prokka annotator). The file is reported in GFF3 format.

FSMMA_smart.gff is the GFF3 file with methylation positions obtained through the sequencer. We performed the analysis using the PacBio RT-SMRT sequencing.

N.B. please note that Prokka and Roary (see Installing MeStudio) can be easily found to Galaxy, the installation of these tools is not strictly needed.

Once this is done, you are going to find all the results inside the directory you started the analysis from. Here's reported a "tree visualization" of the directories hierarchy, assuming that you downloaded the files from the dataset.

├── FSMMA_genomic.fasta
├── FSMMA_anno.gff
├── FSMMA_smart.gff
├── motifs.txt
└── msr
    ├── mscore
    │   ├── GANTC
    │   │   ├── GANTC_CDS.gff
    │   │   ├── GANTC.ms
    │   │   ├── GANTC_nCDS.gff
    │   │   ├── GANTC_true_intergeni.gff
    │   │   ├── GANTC_upstream.gff
    │   │   └── msa
    │   │       ├── output_CDS.bed
    │   │       ├── output_tIG.bed
    │   │       ├── output_nCDS.bed
    │   │       ├── output_US.bed
    │   │       └── Rplots.pdf
    │   ├── genomic_fasta.ms
    │   ├── genomic.ms
    │   ├── matches.ms
    │   ├── nCDS.ms
    │   ├── params.ms
    │   ├── sequencer.ms
    │   ├── true_intergenic.ms
    │   └── upstream.ms
    ├── ms_circ.R

Where: FSMMA_genomic.fasta, FSMMA_anno.gff, FSMMA_smart.gff are the files containing respectevely the genome, genome's annotation and smart sequencing methylation data.

motifs.txt is the text file containing all the motifs you want to look for in the genome. In the above example we used GANTC motif only.

msr, mscore, msa are the directories created respectively from ms_replacR, ms_core and ms_analyzR. Inside these folders you can find the newly produced tabular files as GFFs and BEDs.

All the files with .ms extension are produced by ms_core.

Jump to the Results chapter to see the results produced by MeStudio.

MeStudio ReplacR

In order to properly run MeStudio Core, a pre-processing python-based script named ms_replacR has been implemented and is highly suggested to be used. You can find the source code here. ms_replacR expects four arguments:

  1. -o: output directory, in which results and log files will be written
  2. -anno: genomic annotation, in the GFF3 format
  3. -smart: methylation annotation, a sequencer-produced modified base calls in the GFF3 format
  4. -f: genomic sequence, in .fasta or .fna file format

As a matter of fact MeStudio requires consistent formatting as far as the sequence identifiers are concerned but sometimes the annotation process can lead to genomic headers alterations. By default, ms_replacR changes pipe symbol with the underscore for what concerns “seqid” fields identity and makes sure that numbers and quality of the contigs reported on your file are good.

An example is reported below:

FSMMA_genomic.fna

000000F|arrow

GCCGGTCCAGCGCAAAACCCTCGCTCGGCGTGATCGAGAGTATGCGCTGCGAGCCGAGGT CGGGCCAGAAGAGCTTCGAATTCACGAGCCGGAAATGCGGTGCGACGATAACGCGTTCGA

FSMMA_anno.gff

000000F_arrow Prodigal:2.6 CDS 95 538 . + 0 ID=JPHAALHC_00001

As you can see, the header of the fasta file has a pipe as delimeter while the seqname column of the GFF3 file as the underscore as delimeter. This difference in the formatting syntax can create some troubles and here the last flags are crucial to fix the problem.

Moreover, depending on the annotator, we noticed that sometimes the order in which seqids are found, both in the GFF and fasta, differs. ms_replacR also fixes this kind of anomaly in order to avoid biased results.

How do I run ms_replacR?

Before running ms_replacR, please make sure to have python3.8 (or above) properly installed on your computer. Here you find an "how to install python on Ubuntu" tutorial ;)

After the installation, in order to check the ms_replacR usage, you can run:

python3.8 ms_replacR.py --help

usage: ms_replacR.py [-h] [-out OUTPUTDIR] [-anno GENOMIC] [-f FASTA] [-smart METHYLATION]

optional arguments:
  -h, --help            show this help message and exit
  
  -o OUTPUTDIR, --outputdir OUTPUTDIR
                        path to new files directory
  -anno GENOMIC, --genomic GENOMIC
                        path to file produced by genomic annotator [GFF-file]
  -f FASTA, --fasta FASTA
                        path to genome file [FASTA/FNA-file]
  -smart METHYLATION, --methylation METHYLATION
                        path to file produced by the sequencer [GFF-file]

MeStudio Core

MeStudio core is composed of five software components. These components match the nucleotide motifs to the genomic sequence and maps them to the corresponding category, which are extracted from the annotation file. Categories are defined as follows:

  • protein-coding gene with accordant (sense) strand (CDS)
  • discordant (antisense) strand (nCDS)
  • regions that fall between annotated genes (true intergenic, tIG)
  • regions upstream to the reading frame of a gene, with accordant strand (US)

The components, which in the paper we refer to as executables, are called internally by the pipeline version of MeStudio, in the following order: mscheck, msmine, msfasta, msmatch, msx. There is one additional executable, msread, which gets never called and serves only for debugging purpose for the wizard user. Following is a detailed explanation of what each executable does.

mscheck

mscheck requires four mandatory existing files, i.e., the genomic annotation, the genomic sequence, the methylated base calls, and a list containing the motifs to be scanned. It also expects a non-existing directory in which it will dump all the output. Through two optional arguments it is possible to specify the feature type that is to be extracted from the gff (default: gene) and the limit of nucleotides to include during the upstream category calculation. Note that 'gene' is the default feature type and it will ensure that all CDS fall within the reading frame of the gene, and that the intergenic regions will consist in regions that are between two neighboring and non-overlapping genes. It is highly recommended that if you use MeStudio core outside of a pipeline, you select a non existing name for the output argument in your current working directory. Among others, mscheck will produce a binary file called params.ms in the output directory. This file will serve as input for all the other executables that follow. Note that you cannot pass the directory tree to another user since params.ms stores the absolute paths. Run msread params.ms to see what's inside!

msmine

msmine is intended to "mine" the genomic annotation and compute the four categories reported in the introductory paragraph. In order to do so it calculates the length of each input chromosome, and then uses this information to calculate the range of the upstream and/or intergenic regions that are flanking the first and last feature type (hopefully gene, as we keep default). The rest of the data is taken directly from the annotation file, which however was rendered in a binary version by mscheck to minimize the number of type castings and dynamic memory allocations. msmine populates the output directory with binary files which resemble GFF3 tables and contain nCDS, tIG and upstream information which will be used downstream by the other executables.

msfasta

msfasta also requires the params.ms binary parameters file produced by mscheck, but it is only in charge of rendering the genomic sequence into a better computer-parsable format. Once again a binary file is written in the output directory.

msmatch

The current implementation of msmatch uses a naive matching algorithm to map motif sequences to the reference genome. Albeit the number of comparisons in the worst case is O(m*(n-m+1)), we assumed that the amount of input meaningful motifs seldom exceeds a few dozen. Therefore, we did not make use of more optimized transforms or algorithms for pattern finding, and opted for the most straightforward one. During the naive matching phase, each replicon or chromosome gets loaded into memory in the form of an array of chars (or null terminated C-string) one at a time as both strands are scanned for the presence of the motif sequences, which can hold ambiguity characters. After you run msmatch you will find as many new directories as there were motifs, having each directory containing a binary file which holds motif matching information (such as start, end, strand and exact pattern that was matched). This information, together with the pre-computed categories will be utilized by the last executable in the pipeline, msx, to produce the final output.

msx

The last-but-not-least executable is the one that checks whether the modified bases fall within patterns on the genomic sequence, and bins them by category. msx performs several nested loop calculations and outputs a number of GFF3 files which report the methylation status in every category. A detailed explanation of the output produced by msx is reported in the following paragraph.

MeStudio core output

msx produces GFF3 files that report the methylation status in every category. Following is a description of each of the nine fields:

  1. SequenceID Replicon/Chromosome identifier
  2. Source Normally this would report the algorithm or the procedure that generated this feature. MeStudio reports the category that holds the information (CDS, nCDS, true_intergenic or upstream)
  3. Feature Type Describes what the feature is (default: gene)
  4. Feature Start Start
  5. Feature End End
  6. Score Typically E-values for sequence similarity and P-values for predictions. MeStudio actually reports the distance from the beginning or end of the feature in its reading frame. When a motif is found but no methylation is present on the strand of interest, a 0 is placed instead of a positive integer
  7. Strand The strand on which the methylation lies on. If no methylation is reported, it displays the strand the feature lies on
  8. Phase The name of the (standard) methylated base found in within that motif. When a motif is found but no methylation is present on the strand of interest, a "." is placed instead of a letter
  9. Attributes MeStudio only reports the locus tag of the region in which the motif is found. For CDS and nCDS category this would be the locus tag of the gene that stretches between Feature Start and Feature End. For upstream category this reports the locus tag of the gene to which the region of interest is upstream to, whereas for a true_intergenic category it reports its rightmost gene.

Unless you're interested in your own parsing of the data, you normally wouldn't worry about the binaries and text files that MeStudio core produces, since its output is processed by ms_analyzR. Just so you know, however, we'd like to clarify what columns 6 and 8 report. Column 6 (Score) reports an unsigned integer that represents the distance of the methylated base from the start of the gene it associates with, in its correct reading frame. For example, if you're looking at a CDS GFF3, any methylated base that falls within a gene stretch on the positive strand, and both the gene and the methylation are on the "Plus" strand, you would see the distance from the end of such gene (Feature End). Instead, if the methylation is found on the reverse strand, and also the gene it was found on has its reading frame on the "Minus" strand, then you would see the distance calculated from the beginning of the gene (Feature Start), since it "makes sense" when in its reverse complement form. The distance calculation can be summed up in the following table:

Feature Strand Methylation distance
CDS + + from End
CDS + - 0
CDS - + 0
CDS - - from Start
nCDS + + 0
nCDS + - from End
nCDS - + from Start
nCDS - - 0
upstream + + from End
upstream + - 0
upstream - + 0
upstream - - from End
true_intergenic * * from Start

But again, this is an internal detail that's taken care of by MeStudio, under the hood. Lastly, the 8th column reports the modified base found within the reading frame of the analyzed motif. When the eighth column displays a dot, it means that the motif returned a positive match in that category but it did not contain any modified base in the correct reading frame, or any modified base at all.

MeStudio AnalyzR

MeStudio also implements a post-processing python-based script named ms_analyzR which has to be run on the four GFF3 MeStudio-deriving files. In addition, for comparative genomic analyses a “gene_presence_abscence.csv” file produced by Roary can be used to define the methylation level and patterns of core and dispensable genome fractions, as well as annotating the genes-coded proteins. Here's the mandatory and optional fields required:

usage: ms_analyzR.py [-h] [-o OUTPUTDIR] [-CDS CODING] [-nCDS NONCODING] [-tIG INTERGENIC] [-US UPSTREAM]

  -h, --help            show this help message and exit
  -o OUTPUTDIR, --outputdir OUTPUTDIR
                        path to your output files
  -CDS CODING, --coding CODING
                        MOTIF_CDS.gff file
  -nCDS NONCODING, --noncoding NONCODING
                        MOTIF_nCDS.gff file
  -tIG INTERGENIC, --intergenic INTERGENIC
                        MOTIF_true_intergenic.gff file
  -US UPSTREAM, --upstream UPSTREAM
                        MOTIF_upstream.gff file
optional arguments:
  -chr, --make_chrom    Rearrange your input GFFs for chromosomes
  -s, --strict          If used, this flag stops the analysis when 0 methylations are found in the GFF3.
  -r, --roary           path to 'gene_presence_abscence.csv' file produced by Roary
  -q, --quiet           Running ms analyzR quietly (no stdout)

-chr flag saves into the output directory the GFFs at “chromosome level” rather than “feature level”. Each GFF produced will be characterized not for feature (CDS, nCDS, true intergenic and upstream) but by chromosomes (or contigs), maintaining the MeStudio Core derived contents and layout. -s is strict mode, it's highly suggested to be run and stops the analysis when the GFF3 has no methylations found for that specific motif. -r it's used to read the "gene_presence_abscence.csv" file produced by Roary which allows to know if a specific gene is part of the core or cloud genome. -q for having no stdout.

Results

ms_analyzR produces four different type of results: statistics, tabular files and circular plot.

Statistics A stdout log is provided for each searched motif. Here there's an example for the GANTC motif.

Creating the msa folder ..


Parsing the GANTC on CDS
Number of GANTCs found: 6558
Number of methylated GANTCs found: 6459
Ratio: 0.9849
Highest Methylated Gene: JLDKHMGJ_06681 with 14 methylated GANTCs


Parsing the GANTC on nCDS
Number of GANTCs found: 6561
Number of methylated GANTCs found: 6470
Ratio: 0.9861
Highest Methylated Gene: JLDKHMGJ_06681 with 14 methylated GANTCs


Parsing the GANTC on tIG
Number of GANTCs found: 6141
Number of methylated GANTCs found: 2138
Ratio: 0.3482
Highest Methylated Gene: JLDKHMGJ_00735 with 15 methylated GANTCs


Parsing the GANTC on US
Number of GANTCs found: 18837
Number of methylated GANTCs found: 10738
Ratio: 0.57
Highest Methylated Gene: JLDKHMGJ_04693 with 48 methylated GANTCs

Tabular

chrom chromStart chromEnd name score protein
000000F_arrow 1319 2620 JPHAALHC_00003 2 putative zinc protease
000000F_arrow 5122 6228 JPHAALHC_00006 1 hypothetical protein
000000F_arrow 6357 7052 JPHAALHC_00007 3 6-phosphogluconate phosphatase
000000F_arrow 7237 7920 JPHAALHC_00008 1 HTH-type transcriptional regulator CmtR
000000F_arrow 11274 11780 JPHAALHC_00012 1 hypothetical protein
000000F_arrow 12999 16460 JPHAALHC_00014 3 Chromosome partition protein Smc
... ... ... ... ... ...

Circular plot

Schermata 2022-04-01 alle 10 51 27

Why MeStudio

Third-generation sequencing technologies, namely single molecule real-time (SMRT) and Oxford Nanopore (ONT), have changed the field of genomics bringing an exceptional speedup to analyses such as epigenetic markers detection. These methods are rapidly increasing the number of studies on genome-wide DNA methylation, especially in prokaryotes, where the compact size of genomes allows the generation of whole-genome methylome with relative ease. Consequently, the interest toward computational pipelines which can dig into DNA methylation features in a genome-wide manner is growing. Mestudio allows to understand both qualitatively and quantitatively the methylation distribution along genomic features like coding and non-coding sequences, intergenic regions and upstream elements. Since the role of motif sequences as regulatory elements is widely accepted, MeStudio maps them to the corresponding genomic feature, thus associating the methylated motif to a specific gene and allowing to infer cause/effect relationship.

Reference

Please, cite us from doi: https://doi.org/10.3390/ijms24010159

About

A computational tool for extracting and analyzing methylation features from SMRT reads

Resources

Stars

Watchers

Forks

Releases

Packages

Contributors

Languages