v0.10.3: Visium whitelist demultiplexing, 9T polyT flank and chemistr…

CHANGELOG.md

@@ -8,6 +8,12 @@ This file contains all notable changes to Bambu-Pipe.
 
 ### Changed
 - Increased the minimum adapter overlap in the `PREPROCESS_FASTQ` adapter re-search from the cutadapt default (3 bp) to 10 bp, reducing the number of valid reads discarded due to short chance matches at read ends
+- Shortened the polyT right flank for 3' and Visium chemistries (`flank_seq_config.csv`) from 30 T to 9 T, matching the flexiplex presets; ONT reads rarely call the full 30 T homopolymer, so few reads matched the flank during barcode discovery
+- Visium samples (`visium-v*`) are now demultiplexed directly against the spot whitelist, as recommended by flexiplex; barcode discovery and flexiplex-filter are skipped, replacing the `-u 0` knee detection workaround
+- Updated the supported chemistry names in the README to the official 10x Genomics assay names, with a link to the 10x Genomics long-read compatibility article
+
+### Removed
+- `visium-v4` and `visium-v5` (Visium CytAssist Spatial Gene Expression) chemistries, as these probe-based assays do not produce full-length transcripts
 
 ### Fixed
 - Corrected the 10x3v3 and 10x3v4 end adapter (`rev_primer_f`/`rev_primer_r` in `adapter_seq_config.csv`) to `CCCATGTACTCTGCGTTGATACCACTGCTT`, matching 10x3v2 and Visium; the previous sequence does not occur in these reads, so the adapter was rarely trimmed

README.md

@@ -97,17 +97,15 @@ sample,path,chemistry,technology
 
 *Supported 10x Library Chemistries*
 
-For the following chemistries, the pipeline handles the full workflow — FASTQ preprocessing, genome alignment, and transcript discovery and quantification. Please specify the sample chemistry in the samplesheet as shown:
+For the following chemistries, the pipeline handles the full workflow — FASTQ preprocessing, genome alignment, and transcript discovery and quantification. Please specify the sample chemistry in the samplesheet as shown (see 10x Genomics' [long-read compatibility article](https://kb.10xgenomics.com/s/article/10618695456781-Which-10x-Genomics-assays-are-compatible-with-long-read-sequencing-applications)):
 - `10x3v2` (Single Cell 3' v2)
-- `10x3v3` (Single Cell 3' v3 & Next GEM Single Cell 3' v3.1)
-- `10x3v4` (GEM-X Single Cell 3' v4)
-- `10x5v2` (Single Cell 5' v2)
-- `10x5v3` (GEM-X Single Cell 5' v3)
-- `visium-v1` (Visium Spatial Gene Expression Slide 6.5 mm; serial prefix V1)
-- `visium-v2` (Visium Spatial Gene Expression Slide 6.5 mm; serial prefix V2)
-- `visium-v3` (Visium Spatial Gene Expression Slide 6.5 mm; serial prefix V3)
-- `visium-v4` (Visium CytAssist Spatial Gene Expression Slide 6.5 mm; serial prefix V4)
-- `visium-v5` (Visium CytAssist Spatial Gene Expression Slide 11 mm; serial prefix V5)
+- `10x3v3` (Universal 3' Gene Expression – Single Cell 3' v3 & Next GEM 3' v3.1)
+- `10x3v4` (Universal 3' Gene Expression – GEM-X 3' v4)
+- `10x5v2` (Universal 5' Gene Expression – Next GEM 5' v2)
+- `10x5v3` (Universal 5' Gene Expression – GEM-X 5' v3)
+- `visium-v1` (Visium Spatial Gene Expression for Fresh Frozen; slide serial prefix V1)
+- `visium-v2` (Visium Spatial Gene Expression for Fresh Frozen; slide serial prefix V2)
+- `visium-v3` (Visium Spatial Gene Expression for Fresh Frozen; slide serial prefix V3)
 
 > **Note:** Visium Spatial Gene Expression samples (`visium-v*`) must be run one at a time and require a Loupe manual alignment file. See the [Visium Spatial Gene Expression](#visium-spatial-gene-expression) section for details.
 
@@ -117,7 +115,7 @@ If your dataset uses a chemistry not listed above, or if you prefer to handle FA
 
 *Visium HD*
 
-The pipeline also supports Visium HD samples. See the [Visium HD](#visium-hd) section for more details.
+The pipeline also supports Visium HD 3' Spatial Gene Expression samples. See the [Visium HD](#visium-hd) section for more details.
 
 **Pipeline Configuration**
 

assets/10x_config/adapter_seq_config.csv

@@ -7,5 +7,3 @@ technology,fwd_primer_f,fwd_primer_r,rev_primer_f,rev_primer_r,TSO_f,TSO_r
 visium-v1,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,CCCATGTACTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGTACATGGG,,
 visium-v2,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,CCCATGTACTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGTACATGGG,,
 visium-v3,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,CCCATGTACTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGTACATGGG,,
-visium-v4,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,CCCATGTACTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGTACATGGG,,
-visium-v5,CTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAG,CCCATGTACTCTGCGTTGATACCACTGCTT,AAGCAGTGGTATCAACGCAGAGTACATGGG,,

assets/10x_config/barcode_coordinate_config.csv

@@ -7,5 +7,3 @@ technology,barcode_path,spatial_coordinate_path
 visium-v1,visium-v1.txt,visium-v1_coordinates.txt
 visium-v2,visium-v2.txt,visium-v2_coordinates.txt
 visium-v3,visium-v3.txt,visium-v3_coordinates.txt
-visium-v4,visium-v4.txt,visium-v4_coordinates.txt
-visium-v5,visium-v5.txt,visium-v5_coordinates.txt

assets/10x_config/flank_seq_config.csv

@@ -1,11 +1,9 @@
 technology,left_flank,barcode,umi,right_flank
-10x3v2,CTACACGACGCTCTTCCGATCT,????????????????,??????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
-10x3v3,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
-10x3v4,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
+10x3v2,CTACACGACGCTCTTCCGATCT,????????????????,??????????,TTTTTTTTT
+10x3v3,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT
+10x3v4,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT
 10x5v2,CTACACGACGCTCTTCCGATCT,????????????????,??????????,TTTCTTATATGGG
 10x5v3,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTCTTATATGGG
-visium-v1,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
-visium-v2,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
-visium-v3,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
-visium-v4,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
-visium-v5,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
+visium-v1,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT
+visium-v2,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT
+visium-v3,CTACACGACGCTCTTCCGATCT,????????????????,????????????,TTTTTTTTT

conf/dev.config

@@ -1,7 +1,7 @@
 // Development parameters — not intended for end users
 params {
     bambu_path                  = null
-    valid_chemistries           = ['10x3v2', '10x3v3', '10x3v4', '10x5v2', '10x5v3', 'visium-v1', 'visium-v2', 'visium-v3', 'visium-v4', 'visium-v5']
+    valid_chemistries           = ['10x3v2', '10x3v3', '10x3v4', '10x5v2', '10x5v3', 'visium-v1', 'visium-v2', 'visium-v3']
     valid_technologies          = ['ONT', 'PacBio']
     valid_quantification_modes  = ['no_quant', 'EM', 'clusteredEM']
     save_intermediates          = false

modules/preprocess_fastq.nf

@@ -106,21 +106,21 @@ process PREPROCESS_FASTQ {
     # Store flexiplex search pattern as an array so the '?' wildcards are not expanded as shell globs
     flank_seq=(-x "\$left_flank" -b "\$barcode" -u "\$umi" -x "\$right_flank")
 
-    # Flexiplex filter (barcode filtering)
-    # For visium chemistries, search the whole rank curve instead
-    # (previous runs using the default parameters failed to search the whole rank curve for the inflection point)
+    # Barcode list for demultiplexing
+    # For visium chemistries, every whitelisted barcode is a spot on the slide, so demultiplex against the whitelist directly
+    # For single cell chemistries, discover barcodes, then filter them with the whitelist and inflection point (flexiplex-filter)
     if [[ $meta.chemistry == visium-v* ]]; then
-        max_rank_arg="-u 0"
+        barcode_list=$whitelist
     else
-        max_rank_arg=""
+        flexiplex -p $task.cpus "\${flank_seq[@]}" -f 0 ${sample}_chopper_out.fastq
+        flexiplex-filter -w $whitelist --outfile my_filtered_barcode_list.txt flexiplex_barcodes_counts.txt
+        barcode_list=my_filtered_barcode_list.txt
     fi
-    flexiplex -p $task.cpus "\${flank_seq[@]}" -f 0 ${sample}_chopper_out.fastq
-    flexiplex-filter \$max_rank_arg -w $whitelist --outfile my_filtered_barcode_list.txt flexiplex_barcodes_counts.txt
 
     # Chain commands: Flexiplex demultiplexing -> (Optional) Save intermediate file after flexiplex -> Cutadapt trimming of reverse primer -> \
     # Cutadapt re-search for all primer and TSO sequences to remove non-standard reads -> Reverse complementation of reads for 3' and visium chemistry -> Compression with pigz
     cat ${sample}_chopper_out.fastq | 
-    flexiplex_demux my_filtered_barcode_list.txt | 
+    flexiplex_demux \$barcode_list |
     save_intermediate "${sample}_intermediate_flexiplex.fastq.gz" | 
     cutadapt_trim | 
     cutadapt_re_search |